Animal biotechnology

New technologies developed rapidly have found applications in animal production. Identification of gene
regions with an affect on complex quantitative traits of economic importance will increase genetic gain
and its proportion per year. Recently, genome wide association studies and the use of estimated genomic
breeding values in selection indexes have become very popular. In the present study, potential
applications of genome wide association studies and genomic selection are summarized.

Background and Aim: Pig production remains crucial to the livelihood of farmers in Zambia. However, low production continues to undermine efforts to reduce animal protein deficit; hence, the need emerges to improve production through biotechnology. To contribute to the prediction of their acceptance, this study assessed the attitudes and preferences of traditional farmers toward reproductive biotechnologies by exploring the socio-demographic characteristics of farmers. Materials and Methods: The study conducted a cross-sectional descriptive survey that employed a mixed-methods design with a qualitative-quantitative methodological triangulation. Quantitative data were obtained from 622 respondents using a questionnaire, whereas seven focus group discussions (FGDs) were conducted to obtain qualitative data. Descriptive statistics and thematic analysis were used to analyze quantitative and qualitative data, respectively. Results: The majority (65.1%) of the respondents were low-income ...

"We invite you to submit high quality of research papers in all areas of Life Sciences for the publication in & Trends in Biosciences  & Advances in Life Sciences”.

Dr. S. S. Ali,
Editor – in- Chief , Trends in Biosciences Journal
Editor-in-Chief, Advances in Life Sciences Journal
H-1312, VIP lane, Satayam Vihar, Avas Vikas No.1, Kalyanpur, Kanpur – 208 018. U.P., 
Tele : (Mob.)+91- 9696499966,  7772001059, 9919388690
Email: trendsinbiosciencesjournal@gmail.com , ss_ali@rediffmail.com"

Background and Aim: Pig production remains crucial to the livelihood of farmers in Zambia. However, low production continues to undermine efforts to reduce animal protein deficit; hence, the need emerges to improve production through biotechnology. To contribute to the prediction of their acceptance, this study assessed the attitudes and preferences of traditional farmers toward reproductive biotechnologies by exploring the socio-demographic characteristics of farmers. Materials and Methods: The study conducted a cross-sectional descriptive survey that employed a mixed-methods design with a qualitative-quantitative methodological triangulation. Quantitative data were obtained from 622 respondents using a questionnaire, whereas seven focus group discussions (FGDs) were conducted to obtain qualitative data. Descriptive statistics and thematic analysis were used to analyze quantitative and qualitative data, respectively. Results: The majority (65.1%) of the respondents were low-income ...

The increasing demand for food, the debates regarding the ethics involved in slaughtering animals and the many associated environmental issues promote the emergence of an interesting question: is it possible to substitute conventional meat? In this context, Cultivated Meat (CM) is a promising alternative to replace meat, or at least to complement protein nutrition for humans. This overview aims to show the current technological developments for the production of CM, starting with the tissue engineering used to collect, grow and differentiate the cells, and also the characteristics of matrixes, culture media, types of bioreactors and techniques employed for cell cultivation. In addition, bioeconomy and sustainability issues are discussed, as well as social aspects and policy regulation. Furthermore, the fast growing market is presented, starting with the first meat ball in 2016, passing through some examples of recent funding and operating companies and start-ups, the continuous efforts to lower production costs, besides the most recent patented processes. Finally, and in the light of recent developments, future challenges and expectations for the future of CM are discussed, such as tissue engineering bottlenecks, bioreactor design optimization and public acceptance issues.

Animal biotechnology is one of the main areas of biotechnology which concerns the application of animals, including transgenic animals, in various fields. Even though these transgenic animals can be useful for improving the welfare of humans and animals, the well-being of animals being used in the studies may be negatively affected. Ethical issues relating to experimentation on animals and the production of transgenic animals are discussed in this review, and included here is a consideration of the phenomena of "conditional ethical blindness". Finding alternative protocols including the 4 Rs (reduction, refinement, replacement, and responsibility) to minimize the employment of animals in scientific procedures is one way to solve these problematic issues. These strategies can be successively utilized for certain animal biotechnological protocols and can be used to intelligently avoid unethical manipulation of animals.

Evaluación en campo de un ELISA indirecto, desarrollado con productos antigénicos especie-específicos de Trypanosoma vivax para el diagnóstico de la tripanosomosis bovina. Fases: I-Preparación y rendimiento de los antígenos, y II-Validación del Ac-ELISA homólogo.
Resumen en extenso publicado en: Actas del II Congreso Internacional de Producción Animal Especializada en Bovinos - Resúmenes en Extenso. MASKANA, 8: 7pp. ISBN 1390-6143 (Impreso). ISSN 2477-8893 (Online). Disponible en URL: https://publicaciones.ucuenca.edu.ec/ojs/index.php/maskana/article/view/1481

Fulani herdsmen and farmers conflicts have remained the most predominately resource-use conflict in North-eastern Nigeria especially in Yobe State. The necessity to provide food of crops and animal origin, as well as raw materials for industry and export in order to meet ever-growing demands, has led to extensive use of land. The competition between these two agricultural land user-groups, however, has often times turned into serious concealed and unconcealed manifestation of hostilities and social friction in many parts of Yobe State. The conflicts have demonstrated high potential to exacerbate the insecurity and food crisis particularly in rural communities where most of the conflicts are localized, with reverberating repercussions nationwide. This study describes the traditional relationship between Fulani herdsmen and farmers in the incessant resource conflicts witnessed in Yobe State and how it affects livelihood security of those involved and resource sustainability for the local communities. The study concluded that there is the need to identify the causes, repercussions and proffered resolution of the critical issues that are at the roots of the conflicts.

The increasing demand for food, the debates regarding the ethics involved in slaughtering animals and the many associated environmental issues promote the emergence of an interesting question: is it possible to substitute conventional meat? In this context, Cultivated Meat (CM) is a promising alternative to replace meat, or at least to complement protein nutrition for humans. This overview aims to show the current technological developments for the production of CM, starting with the tissue engineering used to collect, grow and differentiate the cells, and also the characteristics of matrixes, culture media, types of bioreactors and techniques employed for cell cultivation. In addition, bioeconomy and sustainability issues are discussed, as well as social aspects and policy regulation. Furthermore, the fast growing market is presented, starting with the first meat ball in 2016, passing through some examples of recent funding and operating companies and start-ups, the continuous effo...

Aim: Avian pathogenic Escherichia coli (APEC) is pathogenic strains of E. coli that are responsible for one of the most common bacterial diseases affecting poultry worldwide. This study was designed to determine the occurrence, antibiotic resistance profile, and antibiotic resistance genes of E. coli isolated from diseased and freshly dead broilers. Materials and Methods: In that context, a total of 200 broilers samples were examined by standard microbiological techniques for isolation of E. coli, and tested for their antimicrobial susceptibility against 15 antimicrobial agents using disc diffusion method. In addition, E. coli isolates were screened by multiplex polymerase chain reaction for detection of a number of resistance genes including aadA1 gene encodes streptomycin/neomycin, tetA encodes resistance to tetracycline, sul1 encodes sulfonamides, and β-lactamase encoding genes (bla TEM and bla SHV). Results: A total of 73 (36.5%) isolates were biochemically identified as E. coli strains. O78, O2, and O1 are the most prevalent serotypes detected. E. coli displayed a high resistance against penicillin (100%), followed by cefepime (95.8%) and a low resistance to norfloxacin (36.9%), and chloramphenicol (30%). Depending on the results of PCR, sul1 gene was the most predominant antibiotic resistant gene (87%) followed by bla TEM (78%), tetA genes (60%), and aadA (54%). However, bla SHV had the lowest prevalence (23%). Conclusion: The obtained results demonstrated the importance of studies on APEC and antibiotic resistance genes in our region which associated with intensive poultry industry, aiming to acquire preventive measures to minimize losses due to APEC and associated multidrug-resistance and resistance genes that of high significance to the rational use of antibiotics in clinical and public health.

Aim: The present study was undertaken to clone, express and study the immunogenicity of P67 protein of Mycoplasma leachii. Materials and Methods: P67 gene was amplified from genomic DNA of M. leachii. The polymerase chain reaction (PCR) product was inserted in pRham N-His SUMO Kan vector and was used to transform competent Escherichia cloni 10G cells. Recombinant protein expression was done by inducing cells with 0.2% Rhamnose. Purification was done using nickel nitrilotriacetic acid affinity chromatography. Western blot and dot blot analysis were performed to assess the immunoreactivity of P67 protein. Results: PCR amplicon size of P67 gene was found to be 1500 base pair. The size of the fusion protein with SUMO tag was 79 kDa in sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis. The recombinant P67 fusion protein expressed in pRham N-His SUMO Kan vector was found to be immunogenic in both western blot and dot blot analysis. Conclusion: Western blot and dot blot analysis of P67 protein of M. leachii revealed that the protein is immunogenic. Further work is needed to evaluate the role of P67 antigen of M. leachii as an immunodiagnostic agent.

Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.

Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.

Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.

Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

We cordially announce the 21st Euro Biotechnology Congress to be held during October 11-12, 2018 Moscow, Russia. The attending delegates include Editorial Board Members of related international group journals. This is a fabulous open door for the representatives from universities and institutes to communicate with the world class scientists from all across the globe.

Background and Aim: Pig production remains crucial to the livelihood of farmers in Zambia. However, low production continues to undermine efforts to reduce animal protein deficit; hence, the need emerges to improve production through biotechnology. To contribute to the prediction of their acceptance, this study assessed the attitudes and preferences of traditional farmers toward reproductive biotechnologies by exploring the socio-demographic characteristics of farmers. Materials and Methods: The study conducted a cross-sectional descriptive survey that employed a mixed-methods design with a qualitative-quantitative methodological triangulation. Quantitative data were obtained from 622 respondents using a questionnaire, whereas seven focus group discussions (FGDs) were conducted to obtain qualitative data. Descriptive statistics and thematic analysis were used to analyze quantitative and qualitative data, respectively. Results: The majority (65.1%) of the respondents were low-income ...

The aim of this study was to explore a novel microbial enzyme was screened, optimized, characterized and purified from the local soil gram positive and spore forming bacterium and to study their ability to degrade chicken feathers and pretreatment of industrial residues from leather industry. After different biochemical and microbiological tests it was suggested that the organism was Bacillus subtilis. It was also characterized and identified by using a bioinformatics tool PIB that suggests the organism was B. subtilis. The isoelectric point was 5.1 and the optimum temperature for enzyme activity was at 60°C but they can produce feather degrading enzymes at 53°C and at pH 8.5. Native enzyme preparations typically showed a Km and Vmax of 0.40mM and 12,200 U mg-1 , respectively. The proteolytic activity was 21.13 units for the sample. This enzyme was purified by ammonium sulfate fractionation, dialysis, DEAE cellulose chromatography and electrophoretic analysis. The most active enzyme protein preparation could be obtained at the ammonium sulphate level of 60%. In this process the protein were purified to 4.9 fold. Enzymatic dehairing estimation has shown that culture supernatant could dehair of leather completely in a 9 hours of incubation. In future the tanneries will use a combination of chemical and enzymatic processes. The potential use of microbial enzymes in leather and poultry processing industry for promoting the hydrolysis of proteins that showing significant industrial and biotechnological applications.

Aim: The objective of this study was to determine the presence of the variants of canine parvovirus (CPV)-2 in the city of Quito, Ecuador, due to the high domestic and street-type canine population, and to identify possible mutations at a genetic level that could be causing structural changes in the virus with a consequent influence on the immune response of the hosts.

Materials and Methods: Thirty-five stool samples from different puppies with characteristic signs of the disease and positives for CPV through immunochromatography kits were collected from different veterinarian clinics of the city. Polymerase chain reaction and DNA sequencing were used to determine the mutations in residue 426 of the VP2 gene, which determines the variants of CPV-2; in addition, four samples were chosen for complete sequencing of the VP2 gene to identify all possible mutations in the circulating strains in this region of the country.

Results: The results revealed the presence of the three variants of CPV-2 with a prevalence of 57.1% (20/35) for CPV-2a, 8.5% (3/35) for CPV-2b, and 34.3% (12/35) for CPV-2c. In addition, complete sequencing of the VP2 gene showed amino acid substitutions in residues 87, 101, 139, 219, 297, 300, 305, 322, 324, 375, 386, 426, 440, and 514 of the three Ecuadorian variants when compared with the original CPV-2 sequence.

Conclusion: This study describes the detection of CPV variants in the city of Quito, Ecuador. Variants of CPV-2 (2a, 2b, and 2c) have been reported in South America, and there are cases in Ecuador where CVP-2 is affecting even vaccinated puppies.

How to cite this article: Shell WS, Sayed ML, Allah FMG, Gamal FEM, Khder AA, Samy AA, Ali AHM (2017) Matrix-assisted laser desorption-ionization-time-of-flight mass spectrometry as a reliable proteomic method for characterization of Escherichia coli and Salmonella isolates, Veterinary World, 10(9): 1083-1093. Abstract Aim: Identification of pathogenic clinical bacterial isolates is mainly dependent on phenotypic and genotypic characteristics of the microorganisms. These conventional methods are costive, time-consuming, and need special skills and training. An alternative, mass spectral (proteomics) analysis method for identification of clinical bacterial isolates has been recognized as a rapid, reliable, and economical method for identification. This study was aimed to evaluate and compare the performance, sensitivity and reliability of traditional bacteriology, phenotypic methods and matrix-assisted laser desorption-ionization-time-of-flight mass spectrometry (MALDI-TOF MS) in the identification of clinical Escherichia coli and Salmonella isolates recovered from chickens. Materials and Methods: A total of 110 samples (cloacal, liver, spleen, and/or gall bladder) were collected from apparently healthy and diseased chickens showing clinical signs as white chalky diarrhea, pasty vent, and decrease egg production as well as freshly dead chickens which showing postmortem lesions as enlarged liver with congestion and enlarged gall bladder from different poultry farms. Results: Depending on colonial characteristics and morphological characteristics, E. coli and Salmonella isolates were recovered and detected in only 42 and 35 samples, respectively. Biochemical identification using API 20E identification system revealed that the suspected E. coli isolates were 33 out of 42 of colonial and morphological identified E. coli isolates where Salmonella isolates were represented by 26 out of 35 of colonial and morphological identified Salmonella isolates. Serological identification of isolates revealed that the most predominant E. coli serotypes were O1 and O78 while the most predominant Salmonella serotype of Salmonella was Salmonella Pullorum. All E. coli and Salmonella isolates were examined using MALDI-TOF MS. In agreement with traditional identification, MADI-TOF MS identified all clinical bacterial samples with valid scores as E. coli and Salmonella isolates except two E. coli isolates recovered from apparently healthy and diseased birds, respectively, with recovery rate of 93.9% and 2 Salmonella isolates recovered from apparently healthy and dead birds, respectively, with recovery rate of 92.3%. Conclusion: Our study demonstrated that Bruker MALDI-TOF MS Biotyper is a reliable rapid and economic tool for the identification of Gram-negative bacteria especially E. coli and Salmonella which could be used as an alternative diagnostic tool for routine identification and differentiation of clinical isolates in the bacteriological laboratory. MALDI-TOF MS need more validation and verification and more study on the performance of direct colony and extraction methods to detect the most sensitive one and also need using more samples to detect sensitivity, reliability, and performance of this type of bacterial identification.

Isolation of genomic DNA is one of the basic steps in many different molecular analyses. There are a few reports on methods of DNA isolation from milk, but many of them are time consuming and expensive, and require relatively large volumes of raw milk. In this study a rapid, sensitive, and efficient method of DNA extraction from milk somatic cells of various mammals (cattle, sheep, goats, horses) is presented. It was found that milk is a good source of genomic DNA, and to obtain a sufficient amount and quality of DNA, suitable for molecular analysis such as PCR, 10 mL of raw milk is sufficient. Thanks to this method, stress in animals can be reduced during collection of researched material. Therefore, this method could be widely used in molecular analyses.

Objective To compare the effect of human menopausal serum with estrous sheep serum, estrous goat serum, ovine follicular fluid and bovine follicular fluid on in vitro maturation, in vitro fertilization and embryo development of sheep oocytes Method (s) Oocytes were treated in culture with different sera and follicular fluids supplemented media to examine effects on embryo development. Results Basic culture medium supplemented with human menopausal serum, estrous sheep serum and estrous goat serum supported better rates of in vitro maturation, in vitro fertilization and embryo development. Ovine follicular fluid and bovine follicular fluid supplementations supported similar rates of In vitro maturation, In vitro fertilization and embryo development which were lower than those supported by human menopausal serum, estrous sheep serum, estrous goat serum and control medium. Conclusion Human menopausal serum, estrous sheep serum, and estrous goat serum resulted in higher maturation, fertilization and embryo development than ovine follicular fluid, bovine follicular fluid and control media.

Aim: This study aimed to create rapid characterization and genotyping of Pasteurella multocida (PM) protocol using modern molecular biology techniques. Materials and Methods: Thirty bacterial isolates were characterized by capsular and somatic identification using conventional procedure followed by multiplex polymerase chain reaction (PCR), restriction endonucleases analysis (REA), and finally confirmed by sequence analysis. Two local vaccine strains and two field isolates were identified as PM Type A and B. Results: A total of 30 isolates were found positive for PM either morphologically and biochemically; however, multiplex PCR technique identified only 22 isolates as Pasteurella species using universal primers while 8 isolates were found negative for PM. 12 of 22 isolates (54%) were characterized at the same reaction into PM Type A, five isolates (23%) were Type B and the rest five isolates (23%) of tested isolates were negative for Types A, B, and D. Hemorrhagic septicemia Type B: 2 or B: 5 could be identified somatically within PM capsular serogroup B using PCR technique. Somatic characterization of PM was done using REA that could identify all PM Type A into A:1 and all PM Type B into B: 2. These protocols were verified for its accuracy and reliability by sequence analysis of two vaccine strains of PM Type A and B that were characterized previously by biochemical and serological methods as well as two selected isolates from the 22 positive isolates representing PM Type A and B. Conclusion: PCR and REA could confirm the identity of PM and provide a rapid and reliable characterization in comparison with biochemical analysis and conventional serotyping that may take up to 2 weeks. Hence, they can reduce the time needed for polyvalent vaccine production and when the reference antisera are unavailable. Moreover, the identity of Omp-H for vaccine and field strains may provide better data to control Pasteurellosis in Egypt.

Isore DP (2017) Characterization of Salmonella Gallinarum isolates from backyard poultry by polymerase chain reaction detection of invasion (invA) and Salmonella plasmid virulence (spvC) genes, Veterinary World, 10(7): 814-817. Abstract Aim: The aim was to characterize Salmonella enterica serovar Gallinarum isolated from backyard poultry by polymerase chain reaction (PCR) detection of virulence genes invasion (invA) and Salmonella plasmid virulence C (spvC). Materials and Methods: Two strains of Salmonella serovar Gallinarum isolates used in this study were obtained from an outbreak of fowl typhoid in backyard Vanaraja fowl. PCR technique was used for detection of invA and spvC genes using standard methodology. The invA PCR product from one representative isolate was sequenced and compared with other related Salmonella serovars in GenBank data. Results: Salmonella Gallinarum produced expected amplicons of invA and spvC gene products. Nucleotide sequence of 285 bp invA gene was deposited in GenBank with accession no. KX788214. Sequence analysis of invA gene was found conserved in Salmonella serovars and demonstrated 100% homology with closely related serovars of Salmonella. Conclusion: Invasion gene (invA) was found to be highly conserved in Salmonella Gallinarum and highly similar with closely related serovars. The isolates also contained plasmid-mediated spvC gene indicating possession of virulence plasmid.